Protein synthesis worksheet

BIO1 Name: ________________________________ Protein Synthesis Worksheet You isolate the following piece of DNA from a unicorn hair found at a crime scene. 3’TACAAATATAGACCTATAGAAAGCGGGATCCCATTCTACTGGCAATACCGCCTCTACAAAACTCTTTCGTTGGCGCGTTACCCACTCGCCCGCGGCCTCACTGGGTACCCACTCGCCAGTTGCCGGGGGAGTTGCCCATA5’1. Write the corresponding second strand beneath the strand above. *Remember to include the polarity of the second strand! 2. The promoter and termination sequences for unicorns are as follows: Promoter sequence: AATATAGACCTATAGAA Terminator sequence: CCGGGGGAGTTGCCCWrite the pre-­‐mRNA transcript sequence below. *Remember the polarity! 3. What are the three post-­‐transcriptional modifications eukaryotes do to convert a pre-­‐mRNA to an mRNA transcript? 4. Unicorn genes use the following introns: Intron 1: AUGGCGGAGAUGUUUUGAIntron 2: AUGGGUGAGCGGWrite the mRNA transcript below remembering to remove the introns. Spring 2014 1 BIO 1 5. Beginning with the start codon, translate the mRNA transcript and write the amino acid sequence below. Label the N and C-­‐terminus of the polypeptide. 6. Describe the process by which a ribosome assembles amino acids to form a protein. (Describe the three steps of translation). 7. How many molecules of water were released in the synthesis of the above protein? 8. Below is a list of known unicorn genes and their variants. What can you tell about the missing unicorn? MET-­‐THR-­‐ASN-­‐ASP-­‐GLU-­‐GLN-­‐TRP-­‐PHE-­‐TYR-­‐VAL-­‐STOP MET-­‐THR-­‐ASP-­‐ASN-­‐GLN-­‐GLU-­‐TRP-­‐PHE-­‐TYR-­‐VAL-­‐STOP MET-­‐THR-­‐PRO-­‐PHE-­‐HIS-­‐GLU-­‐ALA-­‐ARG-­‐LEU-­‐GN-­‐STOP MET-­‐THR-­‐PHE-­‐PRO-­‐HIS-­‐GLN-­‐ARG-­‐ARG-­‐ILE-­‐GLY-­‐STOP MET-­‐THR-­‐SER-­‐THR-­‐ASP-­‐VAL-­‐ALA-­‐ASP-­‐VAL-­‐ASN-­‐STOP MET-­‐THR-­‐SER-­‐TYR-­‐ASN-­‐VAL-­‐ALA-­‐ASN-­‐VAL-­‐ASP-­‐STOP MET-­‐THR-­‐VAL-­‐GLU-­‐SER-­‐ASN-­‐ARG-­‐ALA-­‐ALA-­‐PRO-­‐GLU-­‐STOP MET-­‐THR-­‐VAL-­‐GLU-­‐SER-­‐ASP-­‐ASN-­‐ALA-­‐VAL-­‐PRO-­‐GLU-­‐STOP MET-­‐CYS-­‐PRO-­‐LEU-­‐LEU-­‐LEU-­‐THR-­‐GLY-­‐ASN-­‐LYS-­‐PRO-­‐STOP MET-­‐CYS-­‐PRO-­‐ILE-­‐LEU-­‐LEU-­‐TYR-­‐GLU-­‐ASN-­‐LYS-­‐PRO-­‐STOP Short ears Long ears Long legs Short legs Long fur Short fur Short snout Long snout Darker fur Lighter fur Spring 2013 2

 

CLICK HERE TO ORDER A SIMILAR PAPER

We pride ourselves in writing quality essays

CLICK HERE TO CONTACT US

Lets Start Working

Plagiarism Free

We use anti-plagiarism software to ensure you get high-quality, unique papers. Besides, our writers have a zero plagiarism mentality

On Time Delivery

Your essay will be delivered strictly within the deadline.  If you have an urgent order, we can do it!

Money Back Guarantee

We offer warranty service, including free revisions, and a right to request a refund incase your expectations are not met!

THE BEST PAPER WRITER HELPER

Our Advantage

  • Say “NO” to plagiarism – FREE plagiarism report as an addition to your paper
  • The lowest prices that fit excellent quality
  • Authorship – you are the one who possesses the paper. We DO NOT re-sale or re-use any of them.

OUR PAPER WRITER HELPER GOODIES

Our Freebies

  • Free Cover Page
  • Free Revisions
  • Free Reference Page
  • Free 24/7 support

Pin It on Pinterest

Share This